Review




Structured Review

Ontores Biotechnologies Inc confluency
Confluency, supplied by Ontores Biotechnologies Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/confluency/confluency/pmc13132798-39-3-8
Average 86 stars, based on 1 article reviews
confluency - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

In Vitro:

Article Title: Kaempferol Improves Alzheimer's Disease by Inhibiting Neuronal Ferroptosis via Activating GPX4 / AKR1C3 Signaling Pathway
Article Snippet: .. Upon reaching 80% confluency, Aβ 1–42 (10 μM, Ontores Biotechnologies, Hangzhou, China) was introduced to establish an in vitro AD model. Kaempferol was administered at a concentration of 10 μM to the PC12 cells, excluding those used for the MTT assay. .. The plasmid encoding AKR1B1 and the corresponding AKR1B1 siRNA (si‐AKR1B1, 5′‐AATGCGTGTCTCGAACTTAACAA‐3′) were procured from GeneChem (Shanghai, China) and were transfected into the cells using Lipofectamine 3000 (Invitrogen, CA, USA).

Concentration Assay:

Article Title: Kaempferol Improves Alzheimer's Disease by Inhibiting Neuronal Ferroptosis via Activating GPX4 / AKR1C3 Signaling Pathway
Article Snippet: .. Upon reaching 80% confluency, Aβ 1–42 (10 μM, Ontores Biotechnologies, Hangzhou, China) was introduced to establish an in vitro AD model. Kaempferol was administered at a concentration of 10 μM to the PC12 cells, excluding those used for the MTT assay. .. The plasmid encoding AKR1B1 and the corresponding AKR1B1 siRNA (si‐AKR1B1, 5′‐AATGCGTGTCTCGAACTTAACAA‐3′) were procured from GeneChem (Shanghai, China) and were transfected into the cells using Lipofectamine 3000 (Invitrogen, CA, USA).

MTT Assay:

Article Title: Kaempferol Improves Alzheimer's Disease by Inhibiting Neuronal Ferroptosis via Activating GPX4 / AKR1C3 Signaling Pathway
Article Snippet: .. Upon reaching 80% confluency, Aβ 1–42 (10 μM, Ontores Biotechnologies, Hangzhou, China) was introduced to establish an in vitro AD model. Kaempferol was administered at a concentration of 10 μM to the PC12 cells, excluding those used for the MTT assay. .. The plasmid encoding AKR1B1 and the corresponding AKR1B1 siRNA (si‐AKR1B1, 5′‐AATGCGTGTCTCGAACTTAACAA‐3′) were procured from GeneChem (Shanghai, China) and were transfected into the cells using Lipofectamine 3000 (Invitrogen, CA, USA).



Similar Products

99
MedChemExpress confluency
Confluency, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/confluency/Chloroquine/10__1096_slash_fj__202504863rr-79-7-20
Average 99 stars, based on 1 article reviews
confluency - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
Sartorius AG maximum confluency
Maximum Confluency, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/confluency/Live+Cell+Analysis+Instruments/pm42032042-37-50-46
Average 99 stars, based on 1 article reviews
maximum confluency - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

86
Yeasen Biotechnology cell confluence
Cell Confluence, supplied by Yeasen Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/confluency/cell+confluence/pm42268903-55-1-16
Average 86 stars, based on 1 article reviews
cell confluence - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

97
Mirus Bio confluency
( A ) Expression profiles of indicated cell-cycle genes across cell-cycle pseudotime determined by tricycle. ( B ) Percentage of cells in each cell-cycle phase in Tfam , Opa1 , Polg KO cells, post-Mixscape, compared to non-targeting gRNA cells. Chi-squared tests with multiple testing correction (Bonferroni); ns, not significant. ( C ) Schematic showing the expression patterns of the PIP-FUCCI fluorescent reporters Cdt1-mVenus and Geminin-mCherry across the cell-cycle. ( D,E ) Gating strategies used to isolate cells for mtDNA CN measurements based on cell-cycle phase for both inter-phase ( D ) and intra-phase ( E ) comparisons. ( F,G ) Western blot ( F ) and ddPCR measurements ( G ) showing KD of TFAM protein ( F ) and reduced mtDNA CN ( G ) in HeLa cells transduced with two independent TFAM gRNAs. Vinculin is shown as a loading control ( F ). Number of individual cells per group is indicated in ( G ), data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test, **** p < 0.0001. ( H ) Map of the human mtDNA, highlighting the 7.5 Kb deletion present in the DeltaH2.1 cybrid cell line. ( I,J ) mtDNA CN ( I ) and heteroplasmy ( J ) of eight clonal populations isolated from the DeltaH2.1 cybrid cell line. Cell numbers per group indicated on graphs. Data presented as mean values +/- SD. One-way ANOVA of the mtDNA CN distributions was significant (p = 0.015); pairwise comparisons of all heteroplasmic clones to Clone 25 (0% heteroplasmy) using Tukey’s post-hoc test; ns, not significant. ( K ) Respirometry of DeltaH2.1 cybrid cells with increasing heteroplasmy levels, using Oroboros, showing baseline respiration (BR), proton-leak (PL), ATP-linked respiration (AR) and maximal respiratory capacity (MC). Three separate assays per clone. Data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test performed for each tested parameter, all significant pairwise comparisons are shown. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. ( L,M ) Growth curves of DeltaH2.1 cybrid clones carrying different levels of heteroplasmy in high ( L ) and low ( M ) glucose culture medium. <t>Confluency</t> values averaged over 8 individual images per timepoint for each clone in each condition, data presented as mean values ± SEM. Figure created in BioRender. Van den Ameele, J. (2026) https://BioRender.com/j3ro7vq .
Confluency, supplied by Mirus Bio, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/confluency/TransIT+-293/pmc13095666-271-7-12
Average 97 stars, based on 1 article reviews
confluency - by Bioz Stars, 2026-09
97/100 stars
  Buy from Supplier

86
Ontores Biotechnologies Inc confluency
( A ) Expression profiles of indicated cell-cycle genes across cell-cycle pseudotime determined by tricycle. ( B ) Percentage of cells in each cell-cycle phase in Tfam , Opa1 , Polg KO cells, post-Mixscape, compared to non-targeting gRNA cells. Chi-squared tests with multiple testing correction (Bonferroni); ns, not significant. ( C ) Schematic showing the expression patterns of the PIP-FUCCI fluorescent reporters Cdt1-mVenus and Geminin-mCherry across the cell-cycle. ( D,E ) Gating strategies used to isolate cells for mtDNA CN measurements based on cell-cycle phase for both inter-phase ( D ) and intra-phase ( E ) comparisons. ( F,G ) Western blot ( F ) and ddPCR measurements ( G ) showing KD of TFAM protein ( F ) and reduced mtDNA CN ( G ) in HeLa cells transduced with two independent TFAM gRNAs. Vinculin is shown as a loading control ( F ). Number of individual cells per group is indicated in ( G ), data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test, **** p < 0.0001. ( H ) Map of the human mtDNA, highlighting the 7.5 Kb deletion present in the DeltaH2.1 cybrid cell line. ( I,J ) mtDNA CN ( I ) and heteroplasmy ( J ) of eight clonal populations isolated from the DeltaH2.1 cybrid cell line. Cell numbers per group indicated on graphs. Data presented as mean values +/- SD. One-way ANOVA of the mtDNA CN distributions was significant (p = 0.015); pairwise comparisons of all heteroplasmic clones to Clone 25 (0% heteroplasmy) using Tukey’s post-hoc test; ns, not significant. ( K ) Respirometry of DeltaH2.1 cybrid cells with increasing heteroplasmy levels, using Oroboros, showing baseline respiration (BR), proton-leak (PL), ATP-linked respiration (AR) and maximal respiratory capacity (MC). Three separate assays per clone. Data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test performed for each tested parameter, all significant pairwise comparisons are shown. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. ( L,M ) Growth curves of DeltaH2.1 cybrid clones carrying different levels of heteroplasmy in high ( L ) and low ( M ) glucose culture medium. <t>Confluency</t> values averaged over 8 individual images per timepoint for each clone in each condition, data presented as mean values ± SEM. Figure created in BioRender. Van den Ameele, J. (2026) https://BioRender.com/j3ro7vq .
Confluency, supplied by Ontores Biotechnologies Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/confluency/confluency/pmc13132798-39-3-8
Average 86 stars, based on 1 article reviews
confluency - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

99
Sartorius AG cell confluence
( A ) Expression profiles of indicated cell-cycle genes across cell-cycle pseudotime determined by tricycle. ( B ) Percentage of cells in each cell-cycle phase in Tfam , Opa1 , Polg KO cells, post-Mixscape, compared to non-targeting gRNA cells. Chi-squared tests with multiple testing correction (Bonferroni); ns, not significant. ( C ) Schematic showing the expression patterns of the PIP-FUCCI fluorescent reporters Cdt1-mVenus and Geminin-mCherry across the cell-cycle. ( D,E ) Gating strategies used to isolate cells for mtDNA CN measurements based on cell-cycle phase for both inter-phase ( D ) and intra-phase ( E ) comparisons. ( F,G ) Western blot ( F ) and ddPCR measurements ( G ) showing KD of TFAM protein ( F ) and reduced mtDNA CN ( G ) in HeLa cells transduced with two independent TFAM gRNAs. Vinculin is shown as a loading control ( F ). Number of individual cells per group is indicated in ( G ), data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test, **** p < 0.0001. ( H ) Map of the human mtDNA, highlighting the 7.5 Kb deletion present in the DeltaH2.1 cybrid cell line. ( I,J ) mtDNA CN ( I ) and heteroplasmy ( J ) of eight clonal populations isolated from the DeltaH2.1 cybrid cell line. Cell numbers per group indicated on graphs. Data presented as mean values +/- SD. One-way ANOVA of the mtDNA CN distributions was significant (p = 0.015); pairwise comparisons of all heteroplasmic clones to Clone 25 (0% heteroplasmy) using Tukey’s post-hoc test; ns, not significant. ( K ) Respirometry of DeltaH2.1 cybrid cells with increasing heteroplasmy levels, using Oroboros, showing baseline respiration (BR), proton-leak (PL), ATP-linked respiration (AR) and maximal respiratory capacity (MC). Three separate assays per clone. Data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test performed for each tested parameter, all significant pairwise comparisons are shown. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. ( L,M ) Growth curves of DeltaH2.1 cybrid clones carrying different levels of heteroplasmy in high ( L ) and low ( M ) glucose culture medium. <t>Confluency</t> values averaged over 8 individual images per timepoint for each clone in each condition, data presented as mean values ± SEM. Figure created in BioRender. Van den Ameele, J. (2026) https://BioRender.com/j3ro7vq .
Cell Confluence, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/confluency/Live+Cell+Analysis+Instruments/pm42055283-96-11-20
Average 99 stars, based on 1 article reviews
cell confluence - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
Sartorius AG confluency
( a) LC-MS of His levels in NMG (n = 7) and MMTV-c- Myc (n = 10) tumours after a 5 min [U 13 C]His bolus. Total abundance (left) and isotopologue distribution (right). Mean ± s.d.; p -values from two-way ANOVA (Šídák’s correction). ( b) Timeline: cells cultured in 2.0 or 0.1 mM Gln (24 h) before 20-min [U 13 C]His administration. ( c) Total relative His abundance (n = 3). Data are mean ± s.d.; p -values from two-way ANOVA (Šídák’s correction). ( d ) RT-qPCR of indicated genes expression in cells cultures in 2.0 mM or 0.1 mM Gln (n = 3), normalized to β-actin and expressed relative to 2.0 mM Gln. Mean ± s.d.; p -values from one-way ANOVA (Šídák’s correction). ( e,f ) WB of cells in 2.0 mM or 0.1 mM Gln (24 h), n = 3; in ( f ) MMTV-c- Myc tumour and liver tissue are used as controls. ( g ) Relative <t>confluency</t> of cells in 0-2.0 mM Gln (96 h), normalized to 2.0 mM Gln; IC50 values from non-linear fit of log[Gln] vs. normalized response (n = 2). ( h ) LC-MS of cells in 2.0 mM or 0.1 mM Gln (24 h), followed by a 10 min [U 13 C]His pulse (n = 3). Labelled His abundance is relative to 2.0 mM Gln. Mean ± s.d.; p -values from one-way ANOVA (Šídák’s correction). See also Figure S2.
Confluency, supplied by Sartorius AG, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/confluency/Live+Cell+Analysis+Instruments/bio_rxiv__64898__2026__04__15__716193-282-14-22
Average 99 stars, based on 1 article reviews
confluency - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

Image Search Results


( A ) Expression profiles of indicated cell-cycle genes across cell-cycle pseudotime determined by tricycle. ( B ) Percentage of cells in each cell-cycle phase in Tfam , Opa1 , Polg KO cells, post-Mixscape, compared to non-targeting gRNA cells. Chi-squared tests with multiple testing correction (Bonferroni); ns, not significant. ( C ) Schematic showing the expression patterns of the PIP-FUCCI fluorescent reporters Cdt1-mVenus and Geminin-mCherry across the cell-cycle. ( D,E ) Gating strategies used to isolate cells for mtDNA CN measurements based on cell-cycle phase for both inter-phase ( D ) and intra-phase ( E ) comparisons. ( F,G ) Western blot ( F ) and ddPCR measurements ( G ) showing KD of TFAM protein ( F ) and reduced mtDNA CN ( G ) in HeLa cells transduced with two independent TFAM gRNAs. Vinculin is shown as a loading control ( F ). Number of individual cells per group is indicated in ( G ), data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test, **** p < 0.0001. ( H ) Map of the human mtDNA, highlighting the 7.5 Kb deletion present in the DeltaH2.1 cybrid cell line. ( I,J ) mtDNA CN ( I ) and heteroplasmy ( J ) of eight clonal populations isolated from the DeltaH2.1 cybrid cell line. Cell numbers per group indicated on graphs. Data presented as mean values +/- SD. One-way ANOVA of the mtDNA CN distributions was significant (p = 0.015); pairwise comparisons of all heteroplasmic clones to Clone 25 (0% heteroplasmy) using Tukey’s post-hoc test; ns, not significant. ( K ) Respirometry of DeltaH2.1 cybrid cells with increasing heteroplasmy levels, using Oroboros, showing baseline respiration (BR), proton-leak (PL), ATP-linked respiration (AR) and maximal respiratory capacity (MC). Three separate assays per clone. Data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test performed for each tested parameter, all significant pairwise comparisons are shown. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. ( L,M ) Growth curves of DeltaH2.1 cybrid clones carrying different levels of heteroplasmy in high ( L ) and low ( M ) glucose culture medium. Confluency values averaged over 8 individual images per timepoint for each clone in each condition, data presented as mean values ± SEM. Figure created in BioRender. Van den Ameele, J. (2026) https://BioRender.com/j3ro7vq .

Journal: Nature Structural & Molecular Biology

Article Title: MitoPerturb-Seq identifies gene-specific single-cell responses to mitochondrial DNA depletion and heteroplasmy

doi: 10.1038/s41594-026-01779-7

Figure Lengend Snippet: ( A ) Expression profiles of indicated cell-cycle genes across cell-cycle pseudotime determined by tricycle. ( B ) Percentage of cells in each cell-cycle phase in Tfam , Opa1 , Polg KO cells, post-Mixscape, compared to non-targeting gRNA cells. Chi-squared tests with multiple testing correction (Bonferroni); ns, not significant. ( C ) Schematic showing the expression patterns of the PIP-FUCCI fluorescent reporters Cdt1-mVenus and Geminin-mCherry across the cell-cycle. ( D,E ) Gating strategies used to isolate cells for mtDNA CN measurements based on cell-cycle phase for both inter-phase ( D ) and intra-phase ( E ) comparisons. ( F,G ) Western blot ( F ) and ddPCR measurements ( G ) showing KD of TFAM protein ( F ) and reduced mtDNA CN ( G ) in HeLa cells transduced with two independent TFAM gRNAs. Vinculin is shown as a loading control ( F ). Number of individual cells per group is indicated in ( G ), data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test, **** p < 0.0001. ( H ) Map of the human mtDNA, highlighting the 7.5 Kb deletion present in the DeltaH2.1 cybrid cell line. ( I,J ) mtDNA CN ( I ) and heteroplasmy ( J ) of eight clonal populations isolated from the DeltaH2.1 cybrid cell line. Cell numbers per group indicated on graphs. Data presented as mean values +/- SD. One-way ANOVA of the mtDNA CN distributions was significant (p = 0.015); pairwise comparisons of all heteroplasmic clones to Clone 25 (0% heteroplasmy) using Tukey’s post-hoc test; ns, not significant. ( K ) Respirometry of DeltaH2.1 cybrid cells with increasing heteroplasmy levels, using Oroboros, showing baseline respiration (BR), proton-leak (PL), ATP-linked respiration (AR) and maximal respiratory capacity (MC). Three separate assays per clone. Data presented as mean values ± SD. One-way ANOVA with Tukey’s post-hoc test performed for each tested parameter, all significant pairwise comparisons are shown. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001. ( L,M ) Growth curves of DeltaH2.1 cybrid clones carrying different levels of heteroplasmy in high ( L ) and low ( M ) glucose culture medium. Confluency values averaged over 8 individual images per timepoint for each clone in each condition, data presented as mean values ± SEM. Figure created in BioRender. Van den Ameele, J. (2026) https://BioRender.com/j3ro7vq .

Article Snippet: Transfections were performed with cells at 80–90% confluency using TransIT-293 transfection reagent (Mirus, MIR2704) according to the manufacturer’s instructions.

Techniques: Expressing, Western Blot, Transduction, Control, Isolation, Clone Assay

( a) LC-MS of His levels in NMG (n = 7) and MMTV-c- Myc (n = 10) tumours after a 5 min [U 13 C]His bolus. Total abundance (left) and isotopologue distribution (right). Mean ± s.d.; p -values from two-way ANOVA (Šídák’s correction). ( b) Timeline: cells cultured in 2.0 or 0.1 mM Gln (24 h) before 20-min [U 13 C]His administration. ( c) Total relative His abundance (n = 3). Data are mean ± s.d.; p -values from two-way ANOVA (Šídák’s correction). ( d ) RT-qPCR of indicated genes expression in cells cultures in 2.0 mM or 0.1 mM Gln (n = 3), normalized to β-actin and expressed relative to 2.0 mM Gln. Mean ± s.d.; p -values from one-way ANOVA (Šídák’s correction). ( e,f ) WB of cells in 2.0 mM or 0.1 mM Gln (24 h), n = 3; in ( f ) MMTV-c- Myc tumour and liver tissue are used as controls. ( g ) Relative confluency of cells in 0-2.0 mM Gln (96 h), normalized to 2.0 mM Gln; IC50 values from non-linear fit of log[Gln] vs. normalized response (n = 2). ( h ) LC-MS of cells in 2.0 mM or 0.1 mM Gln (24 h), followed by a 10 min [U 13 C]His pulse (n = 3). Labelled His abundance is relative to 2.0 mM Gln. Mean ± s.d.; p -values from one-way ANOVA (Šídák’s correction). See also Figure S2.

Journal: bioRxiv

Article Title: Histidine exchange sustains LAT1 activity and proliferation in glutamine-addicted breast cancers

doi: 10.64898/2026.04.15.716193

Figure Lengend Snippet: ( a) LC-MS of His levels in NMG (n = 7) and MMTV-c- Myc (n = 10) tumours after a 5 min [U 13 C]His bolus. Total abundance (left) and isotopologue distribution (right). Mean ± s.d.; p -values from two-way ANOVA (Šídák’s correction). ( b) Timeline: cells cultured in 2.0 or 0.1 mM Gln (24 h) before 20-min [U 13 C]His administration. ( c) Total relative His abundance (n = 3). Data are mean ± s.d.; p -values from two-way ANOVA (Šídák’s correction). ( d ) RT-qPCR of indicated genes expression in cells cultures in 2.0 mM or 0.1 mM Gln (n = 3), normalized to β-actin and expressed relative to 2.0 mM Gln. Mean ± s.d.; p -values from one-way ANOVA (Šídák’s correction). ( e,f ) WB of cells in 2.0 mM or 0.1 mM Gln (24 h), n = 3; in ( f ) MMTV-c- Myc tumour and liver tissue are used as controls. ( g ) Relative confluency of cells in 0-2.0 mM Gln (96 h), normalized to 2.0 mM Gln; IC50 values from non-linear fit of log[Gln] vs. normalized response (n = 2). ( h ) LC-MS of cells in 2.0 mM or 0.1 mM Gln (24 h), followed by a 10 min [U 13 C]His pulse (n = 3). Labelled His abundance is relative to 2.0 mM Gln. Mean ± s.d.; p -values from one-way ANOVA (Šídák’s correction). See also Figure S2.

Article Snippet: Cells were imaged at regular intervals using the Incucyte ® live-cell imaging system, and confluency was quantified using the Incucyte S3 Software (Sartorius v.2021C).

Techniques: Liquid Chromatography with Mass Spectroscopy, Cell Culture, Quantitative RT-PCR, Expressing

( a,b ) WB of replenished cells after amino acid starvation with ( a ) 1.6 mM His ( n = 3) or ( b ) 1.6 mM D-His (n = 2) for 48 h. Protein levels are normalized to mTOR/Vinc and expressed relative to the maximum. ( c ) WB of puromycin incorporation in cells starved or preloaded with 0.12 mM or 1.6 mM His (48 h), then replenished with DMEM. Protein levels normalized to Ponceau and expressed relative to the maximum. A representative of 2 independent replicates. ( b) Time-course of relative abundance of intracellular Leu (left) and Met (right) in DMEM-replenished cells after His preloading (1.6 mM, 48 h). 0 min represents pre-replenishment levels. Mean ± s.d.; p -value from two-way ANOVA (Šídák’’s correction). ( e ) Confluency of DMEM-replenished cells preloaded with His, normalized to pre-replenishment confluency (n = 3). Gompertz growth curve applied. Mean ± s.d.; p- values from two -way ANOVA (Dunnett correction). See also Figure S5.

Journal: bioRxiv

Article Title: Histidine exchange sustains LAT1 activity and proliferation in glutamine-addicted breast cancers

doi: 10.64898/2026.04.15.716193

Figure Lengend Snippet: ( a,b ) WB of replenished cells after amino acid starvation with ( a ) 1.6 mM His ( n = 3) or ( b ) 1.6 mM D-His (n = 2) for 48 h. Protein levels are normalized to mTOR/Vinc and expressed relative to the maximum. ( c ) WB of puromycin incorporation in cells starved or preloaded with 0.12 mM or 1.6 mM His (48 h), then replenished with DMEM. Protein levels normalized to Ponceau and expressed relative to the maximum. A representative of 2 independent replicates. ( b) Time-course of relative abundance of intracellular Leu (left) and Met (right) in DMEM-replenished cells after His preloading (1.6 mM, 48 h). 0 min represents pre-replenishment levels. Mean ± s.d.; p -value from two-way ANOVA (Šídák’’s correction). ( e ) Confluency of DMEM-replenished cells preloaded with His, normalized to pre-replenishment confluency (n = 3). Gompertz growth curve applied. Mean ± s.d.; p- values from two -way ANOVA (Dunnett correction). See also Figure S5.

Article Snippet: Cells were imaged at regular intervals using the Incucyte ® live-cell imaging system, and confluency was quantified using the Incucyte S3 Software (Sartorius v.2021C).

Techniques: